Evaluation of Antioxidant Activity and Treatment of Eczema by Berberine Hydrochloride-Loaded Liposomes-in-Gel.

In this paper, berberine hydrochloride-loaded liposomes-in-gel were designed and developed to investigate their antioxidant properties and therapeutic effects on the eczema model of the mouse. Berberine hydrochloride-liposomes (BBH-L) as the nanoparticles were prepared by the thin-film hydration method and then dispersed BBH-L evenly in the gel matrix to prepare the berberine hydrochloride liposomes-gel (BBH-L-Gel) by the natural swelling method. Their antioxidant capacity was investigated by the free radical scavenging ability on 2,2-diphenyl-1-picrylhydrazyl (DPPH) and H2O2 and the inhibition of lipid peroxides malondialdehyde (MDA). An eczema model was established, and the efficacy of the eczema treatment was preliminarily evaluated using ear swelling, the spleen index, and pathological sections as indicators. The results indicate that the entrapment efficiency of BBH-L prepared by the thin-film hydration method was 78.56% ± 0.7%, with a particle size of 155.4 ± 9.3 nm. For BBH-L-Gel, the viscosity and pH were 18.16 ± 6.34 m Pas and 7.32 ± 0.08, respectively. The cumulative release in the unit area of the in vitro transdermal study was 85.01 ± 4.53 µg/cm2. BBH-L-Gel had a good scavenging capacity on DPPH and H2O2, and it could effectively inhibit the production of hepatic lipid peroxides MDA in the concentration range of 0.4-2.0 mg/mL. The topical application of BBH-L-Gel could effectively alleviate eczema symptoms and reduce oxidative stress injury in mice. This study demonstrates that BBH-L-Gel has good skin permeability, excellent sustained release, and antioxidant capabilities. They can effectively alleviate the itching, inflammation, and allergic symptoms caused by eczema, providing a new strategy for clinical applications in eczema treatment.

Engineered plant extracellular vesicles for natural delivery across physiological barriers.

Extracellular vesicles (EVs) are nanoscale luminal vesicles that participate in the information transfer of proteins, nucleic acids, and lipids between cells, thereby playing a role in the treatment of diseases and the delivery of nutrients. In recent years, plant-derived EVs (PDEVs) containing bioactive compounds have attracted increasing interest due to their better biocompatibility and lower cytotoxicity in healthy tissues. In the biomedical field, PDEVs have been used as cargo carriers to achieve various functions through engineering modification techniques. This review focuses on the biogenesis, isolation, and identification of PDEVs. We discuss the surface functionalization of PDEVs to enhance therapeutic efficacy, thereby improving their efficiency as a next-generation drug delivery vehicle and their feasibility to treat diseases across the physiological barriers, while critically analyzing the current challenges and opportunities.

Comparison of Third-Generation Sequencing and Routine Polymerase Chain Reaction in Genetic Analysis of Thalassemia.

CONTEXT.­: Thalassemia is the most widely distributed monogenic autosomal recessive disorder in the world. Accurate genetic analysis of thalassemia is crucial for thalassemia prevention. OBJECTIVE.­: To compare the clinical utility of a third-generation sequencing-based approach termed comprehensive analysis of thalassemia alleles with routine polymerase chain reaction (PCR) in genetic analysis of thalassemia and explore the molecular spectrum of thalassemia in Hunan Province. DESIGN.­: Subjects in Hunan Province were recruited, and hematologic testing was performed. Five hundred four subjects positive on hemoglobin testing were then used as the cohort, and third-generation sequencing and routine PCR were used for genetic analysis. RESULTS.­: Of the 504 subjects, 462 (91.67%) had the same results, whereas 42 (8.33%) exhibited discordant results between the 2 methods. Sanger sequencing and PCR testing confirmed the results of third-generation sequencing. In total, third-generation sequencing correctly detected 247 subjects with variants, whereas PCR identified 205, which showed an increase in detection of 20.49%. Moreover, α triplications were identified in 1.98% (10 of 504) hemoglobin testing-positive subjects in Hunan Province. Seven hemoglobin variants with potential pathogenicity were detected in 9 hemoglobin testing-positive subjects. CONCLUSIONS.­: Third-generation sequencing is a more comprehensive, reliable, and efficient approach for genetic analysis of thalassemia than PCR, and allowed for a characterization of the thalassemia spectrum in Hunan Province.

Molecular spectrum and prevalence of thalassemia investigated by third-generation sequencing in the Dongguan region of Guangdong Province, Southern China.

BACKGROUND: PCR, Sanger sequencing and NGS are often employed for carrier screening of thalassemia but all of these methods have limitations. In this study, we evaluated a new third-generation sequencing-based approach termed comprehensive analysis of thalassemia alleles (CATSA) to explore the prevalence of thalassemia in the Dongguan region of southern China. METHODS: 19,932 subjects were recruited for thalassemia screening and hemoglobin testing was performed for each of them. Routine PCR was performed for all the hemoglobin testing-positive subjects and CATSA was conducted for randomly selected subjects from hemoglobin testing-positive and negative subjects. RESULTS: In the 2716 subjects tested both by PCR and CATSA, 2569 had the same results and 147 had discordant results between the two methods. Sanger sequencing, specially designed PCR and MLPA confirmed the results of CATSA were all correct. In total, CATSA correctly detected 787 subjects with variants while routine PCR correctly detected 640 subjects with variants. CATSA yielded a 5.42% (147 of 2716) increment compared with routine PCR. In the 447 hemoglobin testing-negative subjects, CATSA identified pathogenic variants in 12 subjects. Moreover, CATSA identified a novel deletion (chr16:171262-202032) in the α-globin gene cluster. As a result, the deduced carrier frequency of α-thalassemia,ß-thalassemia and α-/ß-thalassemia was 5.62%, 3.85% and 0.93%, respectively. CONCLUSIONS: Our study demonstrated CATSA was a more comprehensive and precise approach than the routine PCR in a large scale of samples, which is highly beneficial for carrier screening of thalassemia. It provided a broader molecular spectrum of hemoglobinopathies and a better basis for a control program in Dongguan region.

Antioxidant Activity of Quercetin-Containing Liposomes-in-Gel and Its Effect on Prevention and Treatment of Cutaneous Eczema.

Cutaneous eczema is a kind of skin disease is characterized by inflammation. The main manifestations are various types of dermatitis, eczema, and urticaria. There are usually complications such as erythema, blisters, and epidermal peeling. The quercetin might have a therapeutic effect on cutaneous eczema due to its favorable antioxidant activity and anti-inflammatory effects. Currently, there are few studies on transdermal administration of antioxidant drugs for the treatment of cutaneous eczema. The aim of this study was to prepare quercetin-containing liposomes-in-gel (QU-LG), its antioxidant properties were evaluated, and it was used in the skin of mice suffering from dermal eczema to see if it had preventive and therapeutic effects in an attempt to make it a new option for the treatment of cutaneous eczema. QU-LG was prepared by the injection method to form the quercetin-containing liposomes (QU-L) and evenly dispersed in the natural dissolution of carboxymethylcellulose sodium (1%, CMC-Na). The release of QU-LG across the dialysis membranes was up to 30% and clearance of 1,1-diphenyl-2-picrylhydrazyl (DPPH) was 65.16 ± 3.513%. In anti-oxidation assay QU-LG inhibited malondialdehyde (MDA) production in liver better than the commercially available drug dexamethasone acetate cream. Compared with untreated mice, mice treated with QU-LG showed a statistically significant reduction in dermatopathologic symptoms. The results suggested that QU-LG had good antioxidant activity in vivo and in vitro and could be used for the prevention and treatment of cutaneous eczema.

Artesunate alleviates intestinal ischemia/reperfusion induced acute lung injury via up-regulating AKT and HO-1 signal pathway in mice.

Acute Lung injury (ALI) is a common complication following intestinal ischemia/reperfusion (II/R) injury that can lead to acute respiratory distress syndrome (ARDS) a fatal illness for there is no specific therapy. The semisynthetic artemisinin Artesunate (Art) extracted from Artemisia annua has been found lots of pharmaceutical effects such as anti-malaria, anti-inflammatory, and anti-apoptosis. This study aimed to investigate the effect of Artesunate on intestinal ischemia/reperfusion and the mechanism of how Artesunate works in mice. To establish the II/R model, the C57BL/c mice were subjected to occlude superior mesenteric artery (SMA) for 45 min and 120 min reperfusion, and the lung tissue was collected for examination. Severe lung injury occurred during the II/R, meanwhile Art pretreatment decreased the lung injury score, wet/dry ratio, the level of MDA, MPO, IL-1ß, TNFα, CXCL1, MCP-1, the TUNEL-positive cells, Bax and Cleaved-Caspase3 protein expression obviously, and increased the activity of SOD and the expression of Bcl-2. In addition, the protein of P-AKT and HO-1 were upregulated during the Art pretreatment. Then the AKT inhibitor Triciribin and HO-1 inhibitor Tin-protoporphyrin IX were administered which reversed the protein expression of apoptosis, AKT and HO-1. Our study suggests that Art mitigated the II/R induced acute lung injury by targeting the oxidative stress, inflammatory response and apoptosis which is associated with the activating of AKT and HO-1, providing novel insights into the therapeutic candidate for the treatment of II/R induced acute lung injury.

Wheat rhizosphere colonization by Bacillus amyloliquefaciens W10 and Pseudomonas protegens FD6 suppress soil and in planta abundance of the sharp eyespot pathogen Rhizoctonia cerealis.

AIMS: Develop quantitative assays (qPCR) to determine the wheat rhizosphere competence of inoculant strains Bacillus amyloliquefaciens W10 and Pseudomonas protegens FD6, and their suppressive efficacies against the sharp eyespot pathogen Rhizoctonia cerealis. METHODS AND RESULTS: Antimicrobial metabolites of strains W10 and FD6 decreased in vitro growth of R. cerealis. A qPCR assay for strain W10 was designed from a diagnostic AFLP fragment and the rhizosphere dynamics of both strains in wheat seedlings were compared by culture-dependent (CFU) and qPCR assays. The qPCR minimum detection limits for strains W10 and FD6 were log 3.04 and log 4.03 genome (cell) equivalents g-1 soil, respectively. Inoculant soil and rhizosphere abundance determined by CFU and qPCR were highly correlated (r > 0.91). In wheat bioassays, rhizosphere abundance of strain FD6 was up to 80-fold greater (P < 0.001) than strain W10 at 14 and 28 days postinoculation. Both inoculants reduced (P < 0.05) rhizosphere soil and root abundance of R. cerealis by up to 3-fold. CONCLUSIONS: Strain FD6 exhibited greater abundance in wheat roots and rhizosphere soil than strain W10 and both inoculants decreased the rhizosphere abundance of R. cerealis.

The frequency of HKαα allele in silent deletional α-thalassemia carriers in the Yulin region of southern China using the third-generation sequencing.

OBJECTIVES: α-thalassemia is relatively prevalent in Yulin Region in southern China. In order to accurately detect α-globin gene aberrations for genetic counseling, the prevalence of HKαα (Hong Kong αα) allele in this subpopulation of silent deletional α-thalassemia were examined. MATERIALS AND METHODS: A total of 1845 subjects were selected in Yulin Region from January 2021 to March 2021. Peripheral blood was collected from each participant for routine genetic analysis of thalassemia. The HKαα allele was determined using the Single-molecule real-time (SMRT) technology for samples with -α3.7/αα, ßN/ßN genotype. RESULTS: Two samples were identified with HKαα allele from 100 samples with -α3.7/αα, ßN/ßN genotype. The frequency of HKαα allele was 2.0 % (2/100) in -α3.7/αα, ßN/ßN carriers in Yulin Region. One sample was identified with a novel variant of the α-globin gene cluster named αHKαα by SMRT technology. One rare HBA2 variant and six HBB variants were found by SMRT technology, including -α3.7/HBA2:c.300 + 34G > A, HBB:c.316-45G > C/ßN, HBB:c.315 + 180 T > C/ßN, HBB:c.316-179A > C/ßN. CONCLUSION: A certain proportion of HKαα allele had been detected in Yulin Region. SMRT technology plays a crucial role for improving the diagnostic accuracy and positive detection rate of thalassemia. The completion of this study has great meaning for strengthening the prevention and control of thalassemia in Yulin Region.

First report of Arthrobacter woluwensis causing brown blotch disease on white button mushroom (Agaricus bisporus).

Agaricus bisporus is one of the most commonly grown edible fungi in the world. In December 2021, brown blotch disease (2% incidence) was observed on the cap of A. bisporus, growing in a mushroom cultivation base in Guangxi, China. Initially, brown blotches (1-1.3 cm) appeared on the cap of A. bisporus, which expanded gradually as the cap grew. After two days, the infection penetrated inner tissues of fruiting bodies, and blotches were dark brown. For the isolation of causative agent(s), internal tissue samples of the infected stipes (5×5×5 mm) were sterilized in 75% ethanol for 30 s, rinsed three times with sterile deionized water (SDW), then, mashed in the sterile 2 ml Eppendorf tubes, 1000 µl SDW was added and the suspension was diluted into seven concentrations (10-1~10-7). Each suspension (120 µl) was spread on Luria Bertani (LB) medium and incubated for 24 hours at 28 °C. Morphological examination of the isolates was referred to Liu et al (2022). The dominant single colonies were whitish-grayish, smooth, convex. The cells were Gram-positive, non-flagellated, nonmotile, no pods or endospores formed, and no fluorescent pigments production on King's B medium (Solarbio). Amplified 16S rRNA (1351 bp; OP740790) of five colonies using universal primers 27f/1492r (Liu et al., 2022), exhibited 99.26% identity with Arthrobacter (Ar.) woluwensis. The partial sequences of the ATP synthase subunit beta gene (atpD) (677 bp; OQ262957), RNA polymerase subunit beta gene (rpoB) (848 bp; OQ262958), preprotein translocase subunit SecY gene (secY) (859 bp; OQ262959) and elongation factor Tu gene (tuf) (831 bp; OQ262960) genes of colonies were amplified using the method of Liu et al (2018), also exhibited more than 99% similarities to Ar. woluwensis. The biochemical tests for isolates (n=3) were performed via bacterial micro-biochemical reaction tubes (Hangzhou Microbial Reagent Co., LTD), and the results showed the same biochemical characteristics as Ar. woluwensis (Positive for esculin hydrolysis, urea, gelatinase, catalase, sorbitol, gluconate, salicin and arginine. Negative for citrate, nitrate reduction and rhamnose) (Funke et al., 1996). The isolates were identified as Ar. woluwensis based on morphological characteristics, biochemical tests and phylogenetic analysis. Pathogenicity tests were performed with bacterial suspensions (1 × 109 CFU/ml) after growing for 36 h in LB Broth at 28 °C, 160 rpm. 30 µl bacterial suspension was added to the cap and tissue of young A. bisporus. SDW was added as a negative control. All treatments were incubated at 20 °C and 80-85% humidity. The experiment was repeated three times with five caps and five tissues of young A. bisporus each time. Brown blotches were observed on all the parts of the inoculated caps and tissues after 24 h of inoculation. At 48 h, the inoculated caps turned dark brown while the infected tissues changed from brown to black and expanded to the entire tissue block giving a severely rotten appearance and foul odor. This disease symptoms were similar to those observed in the original samples. There were no lesions in the control group. After the pathogenicity test, the pathogen was re-isolated from the infected caps and tissues based on morphological characteristics, 16S rRNA sequences, and biochemical results, fulfilling Koch's postulates. Arthrobacter spp. are very widely distributed in the environment (Kim et al., 2008). To date, two studies have confirmed Arthrobacter spp. as a pathogen of edible fungi (Bessette, 1984; Wang et al., 2019). However, this is the first report of Ar. woluwensis causing brown blotch disease on A. bisporus. Our finding could contribute to developing phytosanitary and control treatments for this disease.

Evaluating the Clinical Utility of a Long-Read Sequencing-Based Approach in Prenatal Diagnosis of Thalassemia.

BACKGROUND: The aim is to evaluate the clinical utility of a long-read sequencing-based approach termed comprehensive analysis of thalassemia alleles (CATSA) in prenatal diagnosis of thalassemia. METHODS: A total of 278 fetuses from at-risk pregnancies identified in thalassemia carrier screening by PCR-based methods were recruited from 9 hospitals, and PCR-based methods were employed for prenatal diagnosis. CATSA was performed retrospectively and blindly for all 278 fetuses. RESULTS: Among the 278 fetuses, 263 (94.6%) had concordant results and 15 (5.4%) had discordant results between the 2 methods. Of the 15 fetuses, 4 had discordant thalassemia variants within the PCR detection range and 11 had additional variants identified by CATSA. Independent PCR and Sanger sequencing confirmed the CATSA results. In total, CATSA and PCR-based methods correctly detected 206 and 191 fetuses with variants, respectively. Thus, CATSA yielded a 7.9% (15 of 191) increment as compared with PCR-based methods. CATSA also corrected the predicted phenotype in 8 fetuses. Specifically, a PCR-based method showed one fetus had homozygous HBB c.52A > T variants, while CATSA determined the variant was heterozygous, which corrected the predicted phenotype from ß-thalassemia major to trait, potentially impacting the pregnancy outcome. CATSA additionally identified α-globin triplicates in 2 fetuses with the heterozygous HBB c.316-197C > T variant, which corrected the predicted phenotype from ß-thalassemia trait to intermedia and changed the disease prognosis. CONCLUSIONS: CATSA represents a more comprehensive and accurate approach that potentially enables more informed genetic counseling and improved clinical outcomes compared to PCR-based methods.

Identification of a novel 10.3 kb deletion causing α0-thalassemia by third-generation sequencing: Pedigree analysis and genetic diagnosis.

BACKGROUND: α-thalassemia is an inherited blood disorder caused by variants in the α-globin gene cluster. Identification of the pathogenic α-globin gene variants is important for the diagnosis and management of thalassemia. METHODS: Two suspected families from Xiantao, Hubei Province were recruited in this study. The family members underwent hemoglobin testing. Polymerase Chain Reaction based reverse dot blot (PCR-RDB) was employed to identify the known variants. Next-generation sequencing (NGS) and third-generation sequencing (TGS) were performed to screen the potential disease-causing variants, which were validated by Sanger sequencing and multiplex ligation-dependent probe amplification (MLPA). RESULTS: Hematological analysis suggested that proband A had α-thalassemia traits, and proband B had HbH disease traits. However, only a -α3.7 mutation had been detected by PCR-RDB and NGS in the proband of family B. Subsequent TGS identified a novel 10.3 kb deletion (NC_000016.10:g.172342-182690del) covering the HBA1, HBQ1 and HBA2 genes in the α-globin gene cluster in both family A and B, which was confirmed by Sanger sequencing and MLPA. These results indicated that the novel deletion is likely responsible for α-thalassemia. CONCLUSION: A novel α-thalassemia deletion was identified for the two families by TGS. Our work broadened the molecular spectrum of α-thalassemia, and was beneficial for the diagnosis, genetic counseling and management of α-thalassemia.

Back-to-Back Comparison of Third-Generation Sequencing and Next-Generation Sequencing in Carrier Screening of Thalassemia.

CONTEXT.­: Recently, new technologies, such as next-generation sequencing and third-generation sequencing, have been used in carrier screening of thalassemia. However, there is no direct comparison between the 2 methods in carrier screening of thalassemia. OBJECTIVE.­: To compare the clinical performance of third-generation sequencing with next-generation sequencing in carrier screening of thalassemia. DESIGN.­: Next-generation sequencing and third-generation sequencing were simultaneously conducted for 1122 individuals in Hainan Province. RESULTS.­: Among 1122 genetic results, 1105 (98.48%) were concordant and 17 (1.52%) were discordant between the 2 methods. Among the 17 discordant results, 4 were common thalassemia variants, 9 were rare thalassemia variants, and 4 were variations with unknown pathogenicity. Sanger sequencing and polymerase chain reaction for discordant samples confirmed all the results of third-generation sequencing. Among the 685 individuals with common and rare thalassemia variants detected by third-generation sequencing, 512 (74.74%) were carriers of α-thalassemia, 110 (16.06%) were carriers of ß-thalassemia, and 63 (9.20%) had coinheritance of α-thalassemia and ß-thalassemia. Three thalassemia variants were reported for the first time in Hainan Province, including -THAI, -α2.4, and ααααanti3.7. Eleven variants with potential pathogenicity were identified in 36 patients with positive hemoglobin test results. Among 52 individuals with negative hemoglobin test results, 17 were identified with thalassemia variants. In total, third-generation sequencing and next-generation sequencing correctly detected 763 and 746 individuals with variants, respectively. Third-generation sequencing yielded a 2.28% (17 of 746) increment compared with next-generation sequencing. CONCLUSIONS.­: Third-generation sequencing was demonstrated to be a more accurate and reliable approach in carrier screening of thalassemia compared with next-generation sequencing.

[Identification of B(A) Blood Group Serology Combined with Molecular Biology and Blood Transfusion Strategy].

OBJECTIVE: To analyze the reasons for ABO blood group forward typing and reverse typing incompatibility of the proband by serological and molecular biological tests, so as to clarify the blood group and genetic rules and determine the reasonable transfusion strategy. METHODS: On the basis of serological testing results, PCR-SSP method was utilized for the ABO exon sequencing in the peripheral blood of the proband and 5 family members, and blood group results were comprehensively analyzed. RESULTS: The serological results of ABO blood group of the proband were incompatibility, and the molecular biological test results showed that there was a c.700C>G mutation compared with B101, which was consistent with B(A)02 subtype, and the genotype was B(A)02/O02. The results of the elder brother was the same as the proband. The nephew of the proband also detected c.700C>G, genotype A102/B(A) 02. CONCLUSION: When the result of standard serological test for ABO blood group incompatibility occurs, using molecular biology detection technology to explore mutation is an effective method to confirm ABO subtype, and ensures the safety of clinical blood transfusion.

Chromatographic methods for rapid aflatoxin B1 analysis in food: a review.

Aflatoxin B1 (AFB1) is a mycotoxin and is the most carcinogenic of all known chemicals. In view of the AFB1 characteristics of widespread distribution, serious pollution, great harm to humans, and animals and difficult to remove, it is urgent to develop a convenient and sensitive detection method. Moreover, chromatographic test strips (CTSs) are a rapid detection technology that combines labeling technology with chromatography technology. CTSs have been widely used in the fields of environmental monitoring, medical diagnosis, and food safety analysis in recent years. Different from other immune assays, they have the advantages of short measuring time, low cost, high efficiency and no need for professionals to operate. In addition, the introduction of nanomaterials has laid a good foundation for the detection of high sensitivity, high specificity and high efficiency via CTSs. Herein, we tend to comprehensively introduce the applications of chromatographic methods in AFB1 detection and pay attention to the signal detection modes based on nanomaterials in antibody-based immunochromatographic strips (ICSs), such as colorimetric, fluorescent, chemiluminescent, and Raman scattering sensing. Some typical examples are also listed in this review. In the end, we make a summary and put forward prospects for the development of CTSs.

This review is the first systematic review about the applications of antibody-/aptamer-based chromatographic methods for rapid AFB1 detection.Pay attention to the signal detection modes based on nanomaterials in antibody-ICSs, such as colorimetric, fluorescent, chemiluminescent and Raman scattering sensing.Make a summary about some typical examples and put forward prospects for the development of CTSs.

Percutaneous Electroosmosis of Berberine-Loaded Ca2+ Crosslinked Gelatin/Alginate Mixed Hydrogel.

Flexible conductive hydrogel has been driven by scientific breakthroughs and offers a wide variety of applications, including sensors, electronic skins, biomedicine, energy storage, etc. Based on the mixed-ion crosslinking method, gelatin and sodium alginate (Gel-Alg) composite hydrogels were successfully prepared using Ca2+ crosslinking. The migration behavior of berberine hydrochloride (BBH) in the matrix network structure of Gel-Alg hydrogel with a certain pore size under an electric field was studied, and the transdermal effect of berberine hydrochloride under an electric field was also studied. The experimental results show that Gel-Alg has good flexibility and conductivity, and electrical stimulation can enhance the transdermal effect of drugs. Gel-Alg composite hydrogel may be a new material with potential application value in future biomedical directions.

Detection of four rare thalassemia variants using Single-molecule realtime sequencing.

Conventional methods for the diagnosis of thalassemia include gap polymerase chain reaction (Gap-PCR), reverse membrane hybridization (RDB), multiplex ligation-dependent probe amplification (MLPA) and Sanger sequencing. In this study, we used single molecule real-time technology (SMRT) sequencing and discovered four rare variants that have not been identified by conventional diagnostic methods for thalassemia. We also performed genotype and phenotype analyses on family members of thalassemia patients. The SMRT technology detected five cases in which the proband had abnormal results by conventional diagnostic methods or inconsistencies between the genotype and phenotype. The variants included two cases of an α-globin gene cluster 27,311 bp deletion, --27.3/αα (hg38 chr16:158664-185974), one case of an HS-40 region 16,079 bp deletion (hg38 chr16:100600-116678), one case of a rearrangement of -α3.7α1α2 on one allele and one case of a ß-globin gene cluster HBG1-HBG2 4,924 bp deletion (hg38 chr11:5249345-5254268). This study clarified the hematological phenotypes of four rare variants and indicated the application value of SMRT in the diagnosis of rare α-globin and ß-globin gene cluster deletions, gene recombination and deletion breakpoints. The SMRT method is a comprehensive one-step technology for the genetic diagnosis of thalassemia and is particularly suitable for the diagnosis of thalassemia with rare deletions or genetic recombination.

Case Report: The third-generation sequencing confirmed a novel 7.2 Kb deletion at ß-globin gene in a patient with rare ß-thalassemia.

Background: Thalassemia was the most common monogenic diseases worldwide, which was caused by mutations, deletions or duplications in human globin genes which disturbed the synthesis balance between α- and ß-globin chains of hemoglobin. There were many classics methods to diagnose thalassemia, but all of them had limitations. Although variations in the human ß-globin gene cluster were mainly point mutations, novel large deletions had been described in recent years along with the development of DNA sequencing technology. Case report: We present a case of 32-year-old male with abnormal hematological results. However, 23 genotypes of the most common thalassemia were not detected by two independent conventional platforms. Finally, using multiplex ligation-dependent probe amplification (MLPA), third-generation sequencing (TGS) and Gap PCR detection methods, we first confirmed the case with a novel 7.2 Kb deletion (Chr11:5222800-5230034, hg38) located at HBB gene. Conclusion: Our results showed that TGS technology was a powerful tool for thalassemia breakpoint detection, had promising potentiality in genetic screening of novel thalassemia, especially for the novel deletions in globin genes.

A novel rearrangement of the α-globin gene cluster containing both the -α3.7 and ααααanti4.2 crossover junctions in a Chinese family.

BACKGROUND: Thalassemia is one of the most common hemoglobinopathies. Thalassemia is mainly caused by the loss and/or deficiency of one or more globin chains in hemoglobin. The copy number variant (CNV) of α-globin gene is one of the important factors affecting the clinical phenotype of ß-thalassemia. The precise detection for this type of variation is needed. METHODS: Peripheral blood of a 33-year-old man and his family members were collected. Complete blood counts and serum iron levels were measured for participants. Genomic DNA was extracted from all family members. Routine genetic analysis of thalassemia was performed to determine the genotype. Additional PCR-electrophoresis and Multiplex ligation dependent probe amplification (MLPA) were conducted. Single-molecule real-time technology(SMRT) was then performed as a validation assay and further characterization of the variant for family members. RESULTS: PCR-electrophoresis and MLPA found a new variant, but the exact genotype could not be determined. At last, SMRT identified the new variant as a rearrangement of the α-globin gene cluster named αHKαα (NC_000016.9:g.169818_174075dup169818_174075dup173302_177105del), which contained both the -α3.7 and ααααanti4.2 crossover junctions. Carriers of the novel CNV show normal clinical phenotype according to the hematological results. CONCLUSION: We have identified an unreported CNV (αHKαα) in α-globin gene cluster. The novel CNV not only demonstrates the accuracy and efficiency of our combining strategy in detecting unknown CNVs, but also enriched the variant spectrum of thalassemia.

First report of Pseudomonas mosselii causing white blotch disease in Pleurotus pulmonarius in China.

Pleurotus pulmonarius is a popular and widely cultivated edible mushroom in China. In November 2021, white blotch disease (3% incidence) was observed on the cap of P. pulmonarius, growing in a mushroom farm in Nanning, China. Initially, white blotch (0.7-1.6 cm) appeared on the cap of the young P. pulmonarius, which expanded gradually as the cap grew. However, the fruiting bodies still grew well without rotting. The pathogen causing this phenomenon was isolated from infected cap tissues using a dilution plate technique, sections of tissue (approximately 5×5×5 mm) with white blotch were rinsed three times in sterile deionized water, then, mashed in the sterile 2 ml eppendorf tubes, 1000µl sterile water was added and the suspension was diluted into eight concentrations (10-1~10-8). From each concentration, 120µl suspension was spread on Luria Bertani (LB) medium and incubated for 24 hours at 28°C. Both 10-5 and 10-6 suspensions had single colonies, the dominant single colonies were picked and purified 2-3 times. The purified colonies were round, beige, and opaque, with a raised center and regular, smooth and moist margins. This bacterium is gram negative, short rod-shaped, single polar flagellum, motile, without pods or endospores, and produced fluorescent pigments on King's B medium. Amplified 16S rDNA (1396 bp; OM022022) of four randomly selected colonies using universal primers 27f/1492r, exhibited 100% identity with Pseudomonas (Ps.) mosselii. The partial sequences of the rpoB (1173bp; OM202622), rpoD (734bp; ON469579), gyrB (1383bp; OM202621) and recA (887bp; ON469580) genes of four selected colonies were amplified using primers LAPS5/LAFS27(Tayeb et al. 2005.), PsEG30F/PsEG790R (Mulet et al. 2009), gyrB-R/gyrB-F (Agaras et al. 2018) and recA-F (5'-3' ACGACAACAAGAAGCGCGCCTT)/recA-R (5'-3' CAATGGCCGGGTTCTCTTGCAGGTA) designed in this study, respectively, also exhibited 99%~100% similarities to Ps. mosselii. Phylogenetic analysis showed that isolates cluster with Ps. mosselii. The biochemical tests for isolates were performed via bacterial micro-biochemical reaction tubes (Hangzhou Microbial Reagent Co., LTD), and the results showed the same biochemical characteristics as Ps. mosselii (Positive for arginine dihydrolase, trisodium citrate, urea, lysine, arginine, ornithine and gelatin. Negative for glucosamine, lactose, galactose, rhamnose, maltose, sucrose, arabinose, mannose, xylose, esculoside, inositol, nitrate reduction and malonate) (Dabboussi et al.2002; Soto-Rodriguez et al. 2013). The isolates were identified as Ps. mosselii based on biochemical tests and phylogenetic analysis. This isolate was incubated in LB Broth at 28℃, 160 rpm for 24h and the bacterial cells were collected by centrifugation at 4000 rpm for 10min. The collected bacterial cells were resuspended in sterile deionized water to make a bacterial suspension. For pathogenicity tests, 30µl of bacterial suspension (approximately 1x10^9 CFU/mL) was added to the surface of the cap (3-4cm) of young P. pulmonarius. Sterile deionized water was added as a negative control. All treatments were incubated at 22°C and 80-85% humidity. The experiment was repeated three times with three bags each time. 12 h later, white blotches were visible on all parts of the inoculated mushroom. This disease symptoms were similar to those observed in the original samples. However, no disease phenomena were observed in the negative control group. After the pathogenicity test, we obtained the same pathogen as the initially isolates from infected tissues based on morphological characteristics, 16S rDNA sequences, rpoB, rpoD, gyrB and recA sequences, and biochemical test results. Ps. mosselii was first isolated clinically and described by Dabboussi et al. (2002). It has shown to be pathogenic to Oreochromis niloticus and humans (Soto-Rodriguez et al. 2013; Peña et al. 2019; Leneveu-Jenvrin et al. 2013; Huang et al. 2018.). However, to the best of our knowledge, this is the first report of Ps. mosselii causing white blotch disease in P. pulmonarius worldwide, which negatively affects the commercial value of P. pulmonarius and requires attention of mushroom industry.

A novel 15.8 kb deletion α-thalassemia confirmed by long-read single-molecule real-time sequencing: Hematological phenotypes and molecular characterization.

BACKGROUND: Thalassemia is the most frequent recessive Mendelian inherited monogenic disease worldwide, and is characterized by the impaired synthesis of globin chains due to disease-causing variants in α- or ß-globin genes. There are many conventional methods to diagnose thalassemia but all of them have limitations. CASE REPORT: We present the case of a 37-year-old female with abnormal values of routine hematological indices who was admitted for genetic screening of thalassemia. Genomic DNA was extracted and used for genetic assays covering the known and potential novel genotypes in HBA and HBB genes using a suspension-array system, gap-polymerase chain reaction (Gap-PCR), PCR-reverse dot blot (PCR-RDB) and multiplex ligation-dependent probe amplification (MLPA). Finally, using long-read single-molecule real-time (SMRT) sequencing, we first confirmed the case with a novel 15.8 kb deletion located in the HBA gene (Chr16:163886-179768, GRch38/hg38). CONCLUSIONS: Our results showed that long-read SMRT sequencing has great advantages in the detection of rare α-globin gene variants. This study may provide a reference protocol for the use of long-read SMRT sequencing for the detection of known and potential novel genotypes of thalassemia in the population and improve the accuracy of genetic counseling and prenatal diagnosis.